fireduplegmail
Student of: STEM Trimester 2 New Scratcher Joined 2 years, 6 months ago United States
About me
What I'm working on
What I've been doing
Shared Projects (18)
View all-
luca water cycle project by fireduplegmail
-
luca by fireduplegmail
-
luca sound animation by fireduplegmail
-
sound party luca by fireduplegmail
-
luca by fireduplegmail
-
bouncing ball luca vector the 3rd by fireduplegmail
-
Untitled-4 by fireduplegmail
-
animation lllllllluuuuuuuuuuccccccccccaaaaaaaa by fireduplegmail
-
luca Encanto by fireduplegmail
-
luca by fireduplegmail
-
Untitled-2 by fireduplegmail
-
dance party v5000 by fireduplegmail
-
1.6 Maze 10 remix-2 by fireduplegmail
-
1.6 Maze 1 remix by fireduplegmail
-
Animate a Name remix by fireduplegmail
-
lucas project by fireduplegmail
-
dragon fox friends by fireduplegmail
-
my first program by fireduplegmail
Favorite Projects
View all-
luca water cycle project by fireduplegmail
-
Clash Royale Chest by Joshia_T
-
- Pokemon Clicker - by tomergan
-
Armando - movie thingy by mrcoolest1234
-
luca Encanto by fireduplegmail
-
Paper Minecraft v11.7 (Minecraft 2D) by griffpatch
-
1.6 Maze 10 remix-2 by fireduplegmail
-
Geometry Dash Subzero by CrystalKeeper7
-
Animate a Name remix by fireduplegmail
-
Untitled by cat_DM
Studios I Curate
View all-
Lesson 1.10 End of Tri Proj
-
End of Year STEM Projects
-
Water Cycle Science Projects
-
3.1 Hide & Seek Conditionals
-
2.8/ 2.9 Sound Animation
-
Lesson 2.7 Sound Party
-
Lesson 2.6 Sound Boards
-
Lesson 2.4 Vector Animation
-
Lesson 2.3 Animation Effect
-
Lesson 2.2 Animations
-
Movie Magic Block A Project
-
1.8 & 1.9 Virtual Pets
-
Lesson 1.7 Dance Party Project
-
Intro to Scratch Projects
-
Lesson 1.1 Events & Responses
-
Lesson 1.2 Animate a Name
-
Lesson 1.3 XY grid
-
Lesson 1.4 Magic Room Cleaner
-
Lesson 1.5 Projects
Following
View allFollowers
View allComments
- Comments loading...