Newcat_ALT » Favorites (854)
- the tiny cat (vector animation) by MoonlightMagicAlien
- Scratching Dawn - Episode 1 (OLD) by M_axj
- Scratch to the Future 2: Antagonist Man Returns by Tymewalk
- Scratch to the Future by Tymewalk
- Ask Sonicboom363 #10 by Sonicboom363
- Star Fox [Super Nintendo] by Atari-Dude
- Yeah... This Is Result Of Boredon by Dox778
- Brambleclaw has a WHAT?! by Silvershimmer43
- The crossover team collab (V0.11) remix by CehRises
- SCRETCH CAAAAAAAAATTTTTTTTTT by PlasmoReturns
- Lonk from Pennsylvania by ImLonk
- 11th Doctor Dancing!!! by Christophermc0324_2
- Why Timmy Doesn't Listen To Dubstep by The_Guy_
- Chernobyl the Nuclear Foxhog by Scarthehedgehog44
- Custom Doctor Who Theme Songs by Christophermc0324_2
- MATRIXMIX by -BluHead-
- BluHead rages at Bluegary for no entire reason... by -BluHead-
- Scratch gets a 3DS by goomba101
- A mirror remix by gravityfallslegos
- Add yourself becoming/being frozen inside a cave by mlg21
- Scratchy And His Very Productive Friends remix by TheTrueMarioFan
- A Very Productive Happening by Mewser23
- REVERSED by TheFlameOfLloviant
- Body swapping is fun. by waaaa24
- Rolling Around at the Speed of Light by TheFlameOfLloviant
- A Very Productive Dance Party (Fan Mascot edition!) by GlitterpantsCP
- MEOW by MajesticPie
- Hi I did it, too. by -BluHead-
- roomies (Uh why was it unshared?) by BullRusterXxl15
- DO IT! by BullRusterXxl15
- Awesome Samus! by SashaManson14
- You know don't say swears. by SPAsonicspeed1
- Q and A fom Mega Dude by Mega_Dude
- Do you guys remember my past look? by SwagMan354273
- Numa Numa! Test by Dox778
- • I will now try some SAUS • by FurryNerd
- Add yoursef hitting bedrock remix remix by Scarthehedgehog44
- Add yourself shrinken! The remix of a remix^3 remix by tailsmilesprower-fox
- • Blood Moon • by FurryNerd
- A message from the almighty loaf to you by Pterodogtyl
- Where's the Caveman (Lipsync) by TehMLGM4573R3
- Add Yourself On A Couch Resting! remix by olik12
- What will happen by waaaa24
- Welcome! - Introduction to Moonpaw12345 by Moonpaw12345
- [AMV] I Ink Therefore I Am MAP part 5 by Moonpaw12345
- Josh the Hedgehog music:Super Form by Scarthehedgehog44
- Add Yourself Posing for the Picture! by NyanMan09
- I FIGURED OUT HOW THE WORLD OF 3D WORKS. by NyanMan09
- Don't let it get too close to DJ... by NyanMan09
- Sonic Dash [TEST] [WIP] by Dox778
- "Me Show" Ep. 14 "OMG BACK!!!!!!!!!!!!!!!!" by Dox778
- Josh - Fan Art! by Dox778
- The Misadentures of Jawg: Contest by NeonVegas
- Sonic Blur DEMO (new demo coming "soon") by SonicBlurCollab
- my new intro (special motivation) by falcimated
- When I Play Sonic.EXE.... by Dox778
- (OUTDATED) Zevo Character Analysis by zevo
- ZTS Comix - The Crown by zevo
- Zevo Comix??????? WUWUWUUUUU? by zevoRMXS
- ZTS - Equality by zevo