maya-cg
Scratcher Joined 1 year, 7 months ago Mexico
About me
What I'm working on
What I've been doing
Shared Projects (30)
View all-
![]()
Booger Man
by maya-cg
-
![]()
Untitled-2
by maya-cg
-
![]()
DUGINUM
by maya-cg
-
![]()
kittie yo!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
by maya-cg
-
![]()
POKEMON GO! :P remix-2
by maya-cg
-
![]()
adorable kissing koalas!!!
by maya-cg
-
![]()
Grand Prix Racing remix
by maya-cg
-
![]()
Poo poo butt
by maya-cg
-
![]()
yo mama!
by maya-cg
-
![]()
Maybe don't watch this.
by maya-cg
-
![]()
POKEMON GO! :P remix
by maya-cg
-
![]()
catcatcatcatcatcatcatcatcat
by maya-cg
-
![]()
Unit kitty
by maya-cg
-
![]()
Chiken music costumes [you might want to listen to music while you play]
by maya-cg
-
![]()
Poopy life dress up
by maya-cg
-
![]()
??????????????????????#2
by maya-cg
-
![]()
?????????????????????#1
by maya-cg
-
![]()
Bill and his baby
by maya-cg
-
![]()
COLERINA
by maya-cg
-
![]()
Pine tree haeven
by maya-cg
Favorite Projects
View all-
![]()
Naruto and Sasuke Intro
by AvyuktN
-
![]()
Taco Party!
by IvyS-cg
-
![]()
Poopy life dress up
by maya-cg
-
![]()
Remix if you agree =) remix
by cat_lover_360
-
![]()
Chicken guy
by hjg116
-
![]()
Poopy stories
by maya-cg
-
![]()
funny Chicken
by hjg116
-
![]()
kinger spin.
by Socks_my_beloved1
-
![]()
The Amazing Digital Circus Vector Pack
by ReinhartG
-
![]()
Caine From The Amazing Digital Circus!!
by UltraSans27
-
![]()
Wings of balls
by AahilS-cg
-
![]()
penguin bake maze (only on computer)
by AahilS-cg
-
![]()
Let's Make Pride Cake!
by AquaLeafStudios
-
![]()
Let's Make Candies!
by AquaLeafStudios
-
![]()
Let's Make Pie!
by AquaLeafStudios
-
![]()
geometrey dash cat remix
by IvyS-cg
-
![]()
kittie yo!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
by maya-cg
-
![]()
Hypnotize machine
by KaiH-cg
-
![]()
yo mama!
by maya-cg
-
![]()
adorable kissing koalas!!!
by maya-cg
Studios I Curate
View all
Followers
View allComments
- Comments loading...