Beezy_B » Favorites (757)
-
![]()
☆ Toca life character creator / dress up ☆
by Simply_Clair
-
![]()
[RESHARED] Different Habitats || A SDS Project (October 2021)
by RC14600
-
![]()
Not About Angels || TNE
by AlastorzOwls
-
![]()
Im in spain without the "a" Strawberry Crape Cookie and Custard Cookie The lll
by PistlePaints
-
![]()
Undertale ]: )
by Infinitie
-
![]()
Friday night funkin' VS huggy wuggy [DEMO]
by vollrineVPS1
-
![]()
Slime Simulator!
by Unicorngacha55
-
![]()
Games Quiz - Logos! Mobile friendly! Cloud ready! Spot Geometry Dash Angry Birds Minecraft Roblox
by atomicmagicnumber
-
![]()
Lost in Space!
by bugs_bunny16
-
![]()
✦ Landscapes ✦
by tentacus
-
![]()
No spooky art so here's some animations
by TheTrueColeye
-
![]()
Minecraft: Raytraced Version 9
by MyRaycasterArchives
-
![]()
Miner cat - Game
by Coltroc
-
![]()
Miner Cat III
by CatWhisker2018
-
![]()
Chibi Cat Creator
by EggplantWizard7
-
![]()
✂︎-- re-designing scratch ---
by Bubble-Frog
-
![]()
actual trig banana
by Vaibhs11
-
![]()
~✰cat creator!✰~
by spirtfarerluna
-
![]()
I could be red -meme-
by rosedogyy
-
![]()
One Night at The Wolf Pack 5
by Yeatsbear86
-
![]()
enby + agender memes
by AvaJ_71809
-
![]()
Plants Quiz
by kasahihi
-
![]()
The Black Hole
by han614698
-
![]()
Interactive Escape Game
by Channy_3
-
![]()
Hair Dye Simulator!
by ButterPopcorn8
-
![]()
Pokémon TCG Sun&Moon:Base Pack Opening Simulator
by yoreni
-
![]()
Flappy Mario! #games #all #mario #flappy #music #animations #tutorials#art #stories #
by TrentonTNT
-
![]()
(Updated) Stuff I don't want on my profile or projects
by LinkScratchStar
-
![]()
Venus Fly Trap ~ Scratchtober
by malaikaelu
-
![]()
Genderfluid Memes
by gay-bookworm
-
![]()
Paint3D Character Modeling Tutorial
by KawaiiDragon2007
-
![]()
✎Bear Icon Creatorˊˎ-
by ARD_2009
-
![]()
⭑ Art Improvement ?? ⭑
by -butterwaffle-
-
![]()
Comment animations 3 #Animations
by TOADmemer
-
![]()
Scratch Libs 3
by Will_Wam
-
![]()
3D Platformer ✦ Demo v1.91 by TimMcCool
by TimMcCool
-
![]()
When Dinosaurs Lived || A Parallax
by Raptorex73320
-
![]()
Pixel Tamagotchi: Dragons
by scritchscrutch
-
![]()
Fairytale DTA - RESULTS OUT
by zooIights
-
![]()
(UNFINISHED) Super Mario Bros. 3Mastered
by triangle5820
-
![]()
I wanna live..wanna live…
by NattyTheWrench
-
![]()
☽ i wanna live :: template (read desc)
by -astromxlk-
-
![]()
poppy playtime
by graylinwolf
-
![]()
i wanna live meme Ft. huggy wuggy
by Rpeguero67-real-
-
![]()
Huggy Wuggy Vector
by CodeExplode133
-
![]()
oops
by FUZZIE-WEASEL
-
![]()
Queer Book Recommendations Part 1!
by coral4444
-
![]()
Polysexual Memes!
by gay-bookworm
-
![]()
RRRREEEEEEEEEEEEAAAAAAAAAACCCCCCCCCCTTTTTTTTTTIIIIIIIIIIOOOOOOOOONNNN
by scourge1222
-
![]()
First smellable scratch project!
by fuzzypenguin
-
![]()
Snotty Boy Glow Up Meme
by mandalorianpro1
-
![]()
RESULTS OUT
by MochaMonster
-
![]()
Lightningbug Rabbit - Chapter 1 - Gazebo
by 9rainbowtails
-
![]()
Camel by camel (meme) (clean) I just fixed the neck
by TC035002
-
![]()
▬PANIC▬ Meme (Remastered)
by MagicaJaphet
-
![]()
▬PANIC▬ Meme {Cookie Run}
by Pizzaloner123
-
![]()
+ licorice cookie +
by felikiinz
-
![]()
Warrior Dogs: Dark Sky E25
by SilverPUP788
-
![]()
Create your own friendship bracelet! #art #all #trending#games#music
by dragonemerald2627
-
![]()
Continue The Moons Comic
by Juniper_The-Moons
