ADcroc123
Scratcher Joined 4 months, 3 weeks ago Australia
About me
my new account!
What I'm working on
numberblocks band related stuff
What I've been doing
Shared Projects (67)
View all-
Thanks for h0⇂ㄥ6 followers!!! umm what by ADcroc123
-
notd goetf to evst tafoiaf etsalsd bubtre bgrer asaserto sechs dna bernmda by ADcroc123
-
3dADcroc by ADcroc123
-
118 by ADcroc123
-
Scratch errors band by ADcroc123
-
catcatcatcatcatcatcatcatcatcatcatcatcat by ADcroc123
-
spincat by ADcroc123
-
baslairepa, 12 by ADcroc123
-
do me by ADcroc123
-
baslairepa, 11 by ADcroc123
-
breadman the game by ADcroc123
-
118 by ADcroc123
-
47 popsicle by ADcroc123
-
9 ,7sab by ADcroc123
-
watshapening7, 7, S2, 3 by ADcroc123
-
twenty-diss by ADcroc123
-
2̴̥̃1̷̮͛ ̴̺̽,̸͎̄4̶͚͒s̴̡̀ä̷̭́b̵̲̈́ by ADcroc123
-
sub by ADcroc123
-
bas4, 12 OVEREXAGGERATED by ADcroc123
-
I'm 11! by ADcroc123
Favorite Projects
View all-
Don't forget to Steve meatloaf salted butter burger toaster cheese and breadMan by RobotTurtle1234
-
⠀⠀⠀✅✅✅✅✅✅✅✅ ⠀⠀⠀✅✅✅✅✅✅✅✅ ⠀⠀⠀✅⬛⬛✅✅⬛⬛✅ ⠀⠀⠀✅⬛⬛✅✅⬛⬛✅ ⠀⠀⠀✅✅✅⬛⬛✅✅✅ ⠀⠀⠀✅✅⬛⬛⬛⬛✅✅ ⠀⠀⠀✅✅⬛⬛⬛⬛✅✅ ⠀⠀⠀✅✅⬛✅✅⬛✅✅ by _-duckies-_
-
Numberblocks Perfect Numbers Band by seyis2011
-
ScratchTube by RobotTurtle1234
-
Numberblocks Factored Fermat Numbers Band by Fedthewolf
-
bas5, 25 by RodolfoYT12345
Studios I'm Following
View allStudios I Curate
View allFollowing
View allFollowers
View allComments
- Comments loading...