ADcroc123
Scratcher Joined 5 months, 2 weeks ago Australia
About me
my new account!
What I'm working on
What I've been doing
Shared Projects (75)
View all-
19 sub by ADcroc123
-
Fareteen sub by ADcroc123
-
baslairepa, 15 by ADcroc123
-
baslairepa, 14 by ADcroc123
-
i am 118 by ADcroc123
-
new OC by ADcroc123
-
baslairepa, 13 by ADcroc123
-
Don't Forget To (instrumental) by ADcroc123
-
Thanks for h0⇂ㄥ6 followers!!! umm what by ADcroc123
-
notd goetf to evst tafoiaf etsalsd bubtre bgrer asaserto sechs dna bernmda by ADcroc123
-
3dADcroc by ADcroc123
-
118 by ADcroc123
-
Scratch errors band by ADcroc123
-
catcatcatcatcatcatcatcatcatcatcatcatcat by ADcroc123
-
spincat by ADcroc123
-
baslairepa, 12 by ADcroc123
-
do me by ADcroc123
-
baslairepa, 11 by ADcroc123
-
breadman the game by ADcroc123
-
118 by ADcroc123
Favorite Projects
View all-
Don't forget to Steve meatloaf salted butter burger toaster cheese and breadMan by RobotTurtle1234
-
⠀⠀⠀✅✅✅✅✅✅✅✅ ⠀⠀⠀✅✅✅✅✅✅✅✅ ⠀⠀⠀✅⬛⬛✅✅⬛⬛✅ ⠀⠀⠀✅⬛⬛✅✅⬛⬛✅ ⠀⠀⠀✅✅✅⬛⬛✅✅✅ ⠀⠀⠀✅✅⬛⬛⬛⬛✅✅ ⠀⠀⠀✅✅⬛⬛⬛⬛✅✅ ⠀⠀⠀✅✅⬛✅✅⬛✅✅ by _-duckies-_
-
Numberblocks Perfect Numbers Band by seyis2011
-
ScratchTube by RobotTurtle1234
-
Numberblocks Factored Fermat Numbers Band by Fedthewolf
-
bas5, 25 by RodolfoYT12345
Studios I'm Following
View allStudios I Curate
View allFollowing
View allFollowers
View allComments
- Comments loading...