78LogosFan » Shared Projects (178)
-
![]()
this account is officialy closed
by 78LogosFan
-
![]()
try to draw my oc! remix remix
by 78LogosFan
-
![]()
Welcome to the Toys R Us Universe. Im A Otter
by 78LogosFan
-
![]()
A potential new logo for my account remix
by 78LogosFan
-
![]()
Toys R Us font vector remix
by 78LogosFan
-
![]()
Minceraft's Rating Stand remix
by 78LogosFan
-
![]()
Im In DirecTV in a nutshell
by 78LogosFan
-
![]()
How to get out of a Phone call #animation #trending remix
by 78LogosFan
-
![]()
New OC and Thumbnail for my main account when it reaches 275 projects remix
by 78LogosFan
-
![]()
AY: Sing along for you, Called Tim And Harry Show Song! (2) remix remix
by 78LogosFan
-
![]()
Peanut, Butter and Jelly Otter V4 remix
by 78LogosFan
-
![]()
OC remix-2
by 78LogosFan
-
![]()
78LogosFan And My Friends
by 78LogosFan
-
![]()
GBH_OtterBob PinkPants: Is Beeeeeep is instrument?
by 78LogosFan
-
![]()
Edvartbob Blackpants When Interupting
by 78LogosFan
-
![]()
Ay Running To The Home (1) remix
by 78LogosFan
-
![]()
My OC Rating Stand remix
by 78LogosFan
-
![]()
Me And Outfits Please!
by 78LogosFan
-
![]()
A Funny Scary Image Laughed You!
by 78LogosFan
-
![]()
For @N2Rays
by 78LogosFan
-
![]()
CATATATATATATATATAATATATATA
by 78LogosFan
-
![]()
me when I hear the eas alarm for tornadoes Fixed
by 78LogosFan
-
![]()
Klasky Csupo Vector! remix
by 78LogosFan
-
![]()
TGEAS Alert
by 78LogosFan
-
![]()
EAS during Edvartbob Blackpants: Liar Liar Plants for Hire Fixed
by 78LogosFan
-
![]()
newer jumpstart (WITH ASSETS) remix
by 78LogosFan
-
![]()
For @N2Rays
by 78LogosFan
-
![]()
Otter Find Theme Song
by 78LogosFan
-
![]()
Otter Find Theme Song V5
by 78LogosFan
-
![]()
new, new intro remix
by 78LogosFan
-
![]()
My Numberblock 1.875
by 78LogosFan
-
![]()
Thumbnail template remix
by 78LogosFan
-
![]()
Dayton2949's NEW Remix Level Challenge Thumbnail Template (As of Season 2) remix
by 78LogosFan
-
![]()
Me And Thumbed Reveal Family
by 78LogosFan
-
![]()
AY In: TTYD Game Over Screen (8)
by 78LogosFan
-
![]()
How to Design JumpStart Letter Characters Well remix-2
by 78LogosFan
-
![]()
How to Design JumpStart Letter Characters Well remix
by 78LogosFan
-
![]()
AGAIN!?!?!?
by 78LogosFan
-
![]()
Untitled-9
by 78LogosFan
-
![]()
The Wario Apparition & Anti Piracy
by 78LogosFan
-
![]()
add yourself in a zoom meeting
by 78LogosFan
-
![]()
FIXED remix
by 78LogosFan
-
![]()
My Reaction To Bad Thing #3 ( Peanut Otter)
by 78LogosFan
-
![]()
Give Me Your OC & Will Be noedolekciN Form remix remix
by 78LogosFan
-
![]()
New Thumbnail remix
by 78LogosFan
-
![]()
OC remix
by 78LogosFan
-
![]()
Other Oc
by 78LogosFan
-
![]()
Project Thumbnail! remix
by 78LogosFan
-
![]()
I'll draw your OCs! remix
by 78LogosFan
-
![]()
Garfield Answers The Door remix
by 78LogosFan
-
![]()
Give Me Your OC Or Character so I can turn it into a Dumb Ways to Die Style remix
by 78LogosFan
-
![]()
Give Me Your OC or Character Or Flag remix
by 78LogosFan
-
![]()
Other OC & Logo remix
by 78LogosFan
-
![]()
My new OC Felipebross remix
by 78LogosFan
-
![]()
Me
by 78LogosFan
-
![]()
Bross Maker! remix
by 78LogosFan
-
![]()
AY In Super Mario Run (6)
by 78LogosFan
-
![]()
my dwtd oc remix
by 78LogosFan
-
![]()
Message For Edvart
by 78LogosFan
-
![]()
AY as a Lil Guy! (14)
by 78LogosFan
