Download this project! Project Notes
lets get the most tags in the history of scratch!!!!!!!!!!!
dont forget to click loveit!!
Tags
- game
- music
- animation
- art
- math
- simulation
- scratch
- cool
- story
- fun
- d
- hello
- and
- not
- random
- awesome
- mario
- halloween
- space
- hi
- vista
- that
- annoying
- ninja
- pop
- blue
- tags
- tag
- wow
- yes
- hello world
- time
- naruto
- dead
- cow
- moo
- football
- spongebob
- loading
- mudkip
- cats
- hahaha
- add tags
- monkey
- ok
- super
- nice
- sonic
- randomness
- milk
- add
- a
- b
- c
- e
- f
- g
- h
- i
- j
- k
- l
- m
- n
- o
- p
- q
- r
- s
- t
- u
- v
- w
- x
- y
- z
- ?
- flying
- pokemon
- think
- megaman
- yo
- target
- meow
- alphabet
- remix
- cheese
- pie
- epic
- goku
- help
- day
- flag
- bob
- pretty
- too many tags
- text
- luigi
- cool!
- this
- is
- no
- 1
- 2
- 3
- 4
- 5
- 6
- 7
- 8
- 9
- 123
- link
- zelda
- hola
- coolio
- im bored
- of
- me
- portal
- so cool
- die
- waffles
- brains
- !
- whoa
- jews
- poo
- mortal kombat
- metroid
- yay!
- /
- :)
- your
- tagger
- go
- gir
- lag
- pancakes
- you
- poor
- ipod
- toad
- peach
- :d
- chicken
- rain
- xp
- all
- wait
- hehe
- make
- club
- =p
- are
- ??
- #
- qwertyuiop
- zxcvbnm
- lots of tags
- so
- why
- burp
- samus
- views
- rayman
- scout
- smileys
- ol
- lalalalala
- plz
- :3
- 23
- dragon ball z
- an
- meme
- spongebob squarepants
- abercrombie
- scratch cat
- pandas
- xd
- ╣
- qwe
- -
- 12
- 1234567890
- hamster
- come
- abc
- coffee
- got
- asd
- sparta
- hey hey hey
- ??????
- fail
- +
- trouble
- check
- kombat
- <3
- ☺
- boing
- dialga
- palkia
- adder
- blarg
- problem
- blooper
- bye
- will
- wipeout
- all your base
- christmas tree
- :o
- sonic!
- palm trees
- shy guy
- loveits
- ii
- hyper sonic
- scratch.mit.edu
- extra
- many
- tags!
- cupcakes
- loveit
- qwerty
- ytdj
- ninja cat
- lawl
- more tags
- mixer
- 6 views
- midnight
- ooooo
- ????????????
- !!!!!!!!!!!!!!!!!
- !!!!!!!!!!!!
- pencils
- holy cow
- ♥
- ☻
- zipper
- oranges
- ?????????????????????????
- leek spin
- link to this project
- cheez
- o_o
- cr@p
- ik
- ♦
- ♣
- ♠
- •
- ◘
- ○
- ♀
- §
- ↔
- *
- 16
- cardboard
- kk
- everything
- 5 views
- 3 views
- keep adding tags
- tagging is fun
- gg
- [+]
- do ya like waffles?
- i like tags
- i like pie!
- milo
- everyone
- my little pony
- much
- no thank you
- anti-waffles
- a test
- tag army
- likes
- hfd
- 0.0
- im leaving
- cucumbers
- mudkips
- hmm
- iron maiden
- llama!
- weegee
- ._.
- holy cow!
- fy
- tag tag tag
- pandas!
- seizures
- *tags*
- edc
- ice cream and cake
- team fortress
- a lot of tags
- abcdefg
- aaaaaaaaaaaaaaaa
- fat albert
- symbols
- duper
- most tags ever
- nike
- ----------------------
- epic fail
- add more tags!
- ☣
- cool idea
- fdg
- yes i am
- shoop da woop
- ☠
- :9
- agreed
- hollister
- adidas
- close
- .........................
- √
- zxc
- yay!!!!!!!!!!!!!!!!!
- aeropostale
- qwertyuiopasdfghjklzxcvbn
- =3
- eeeeeeeeeeeeeeeeeeeeeeeee
- rick roll
- ytp
- moosebutter
- its over 9000
- _________________________
- never gonna give you up
- aaaaaaaaaaaaaaaaaaaaaaaaa
- you want it?
- rah
- question mark
- hhhhhhhhhhhhhhhhhhhhhhhhh
- ggggggggggggggggggggggggg
- lllllllllllllllllllllllll
- -------------------------
- its over 9000!
- revision
- red ninja
- http://scratch.mit.edu/
- tag tag
- qwert
- add tags!
- fun...
- tags!!!
- how many tags are there?
- 1 view
- awesome!!!!!!!!!!!
- funkeys
- jurk
- ________
- •◘○♦♣♠☺☻♥
- nomnom
- 2 views
- look here
- hihihihi
- jjjjjjjjjjjjjjjjjjjjjjjjj
- adventure time
- 1111111111111111111111111
- wow lots of tags
- 37
- 84
- funny funny funny
- bankai
- rick astely
- holly
- ima firin mah lazer!
- a tag
- taggier
- yuppers
- eek!
- never gonna let you down
- ghui
- kaj
- nigahiga
- fear me
- itouch
- bobs
- 1234567891011121314151617
- wow so many tags!!!
- i added tags
- the name
- byebye
- tinkey
- bvc
- twilight sucks
- iam
- 4 views
- i like adding tags
- for what?
- perry the platapus
- _______________________
- is alot
- ¬
- soooo many tags
- ☀
- xz
- new super mario bros wii
- pie?
- what????
- ddddddddddddddddd
- ilove
- shadic
- wafer biscuit
- supper mario
- tagtagtagtagtag
- once upon a time
- abracadabra
- wafer
- llamallama
- oooooooh
- thegenius95 wuz here
- 8 views
- all your base are
- all your base are belong
- aaaaaaaaaaaaahhhhhhhhhhhh
- noooooooooo!!!!!!!!!!!!!!
- :d :d :d :d :d
- uiop
- ahhhhhhhhhhhhhhhhhhhhhh
- justin beiber
- cuss word
- never gonna run around
- and desert you
- all your
- annoying orange
- mmww
- i tagged it
- lololololo
- flagger
- toffee
- i am a tagger
- bss
- kenichi10
- 2011
- tagtagtagtagtagtagtagtag
- liu kang
- thats alot of tags
- too many tags!!!!!
- qaz
- wsx
- rfv
- tgb
- yhn
- ujm
- sign your name
- click [+]
- ilikecheez
- 11 views
- am not
- emaildigggooglemessengerf
- chachacha
- über
- thecomputernerd01
- >:b
- cats are cute
- explosions!!!!
- exclamation
- ▒
- .o.
- chickpeakids
- i got your number
- hidudes
- zanni loves it!
- nevah!
- somanytags
- zanni doesnt get it.
- dont you dare tag sarcasm
- emberclaw was here
- i haz
- hyphen
- -------
- tag or else
- ♫music♫
- hollyice14
- gome
- cheez!!!
- goham
- cake now~!
- go+me= go-me!!!!
- cmon peepz
- .o
- thx all tagers!
- [.]
- gokiki
- zanni wuz here
- iliketurkeyto
- add tags to the tags
- touch?
- cooless
- hello guys
- dudetes
- himans
- gosticky
- add more eem!
- he-he
- thank u zanni and eem
- histo- splat!
- smushified
- most tags project?
- most tags ever!!!!
- ♥ ♫music♫music♫ ♥
- even though ur my friend.
- i will get platform's mor
- goeem
- vbbo8ybr
- b3v
- bbcv
- `111111111111111111111111
- jamiejamjams was here
- sportsguy596 was here
- chez wegge
- pichu999 tagged this
- tags that get good review
- ☢
- raadiioactiive
- a cupcake!
- and an idea
- ilovekittycats
- i haz another
- i pledge to
- no matter what
- radioctive scratch
- tetanus
- all students who ate
- the ravioli today
- and are not up to date
- on thier tetanus shots
- go see the nurse
- immediatley!!!
- i don't like glee xd
- death to the
- random protoza
- did i really add 26 tags
- in the space of 3 mins???
- pikachu!!!!!
- barf!
- tag goes here
- lalama
- humfjhdb
- winkysquirt was here
- adams_friend was here
- here's a llama there's a
- ------------------------
- -480592
- gshrsgfjg
- cube_roller_3
- 7 views
- 9 views
- 10 views
- cvbnm
- hoiiii
- the most tags ever on scr
- tags sooooo much tags!!!!
- this is the 345th tag
- 345 tags
- wow really cool tags
- treaderdare5 was here
- i here talking in my kitc
- merry christmas tags
- drunk hippie*************
- cheezester was here
- sonic and his tags
- cheezester
- the most wanted tag ever!
- me2000
- my tag is so cool
- lets talk is it raining??
- i made 17 tags so far
- my sister katherine485
- soccerboy3865 was here
- scratchthecat was here
- magicalboy was here
- tammygirl2 was here
- hocus pocus!!!
- magicanfan01 was here
- psychofan000000 was here
- chocolatefan7 was here
- katherine32334 was here
- chrismas57674 was here
- santared56 was here woot!
- baseballfan01fan01 here
- basketballs was here
- black134 was here
- the tag!!!!!!!!!!!!!!!!!!
- there is like 450 tags
- dippy245 was here
- mayo1 was here
- victorialove384 was here
- cheese4 was here today
- yogi bear the movie
- part 1 on youtube!
- after making tags
- divagirl4ever was here
- webkinzdreamgirl2 here
- mattattack was here
- pizzapie99999999999999999
- i love cheese duh ppl
- adding tags is soooo fun
- 500 tags award yay!!!!!!!
- if we get to 1000
- i would write 1000th tag!
- charlesbender12345 here
- stop and shop rocks!!!!!!
- black134 cool projects!!!
- icarlyyyyyyydotcom
- im a dude with lots of to
- google this project!!!!!!
- join club penguin today!!
- join club penguin today!
- join club penguin today
- agent500 was here
- icy mcgoo
- 515 tags
- december 24th is tomorrow
- abc123def456ghi789
- i want 6000000000000 tags
- billybob made a tag?!?!?!
- i made 50 tags i think
- old navy
- 1234567890-=[]\';/.
- ~!@#%
- carly sam freddy
- uncle clifford is here!!!
- my tag is soooo awesome!!
- shaw lover
- buckle boot
- mr tabs alot!!!!!!!!!!!!!
- maskman
- game on!!!!!!!!!!!!!!!!!!
- add tags add tags
- 550 tags yes!!!!!!!
- japanese idiot fell down
- what you love is what i
- 24:00 in my country
- bearded dragon
- x_____________
- add so many tags
- neva gunna give u up
- neva gunna let you down
- mmmmorshu was here
- endless taggggggggggggggg
- ggg'ggggggggggggggggggggg
- gggggggggggggggggggggghgg
- gggggggggggggggoggggggggg
- ppppppppppppppppppp
- go tags
- cancel
- i a tag fear me
- melove
- tags so
- muchh
- melike
- cheez so
- mmuucchh
- toffeecoffee
- coffeetoffee
- mudkipkip
- mudmudkip
- mudkipmud
- kipmudkip
- mudmudkipmud
- kipkipmudkip
- i heard you like mudkips!
- mudkip likes coffee
- mudkip likes toffee
- mudkipmonscoffeeandtoffee
- mudkipnomstoffeeandcoffee
- mudkipismadeofcoffee
- mudkipismadeoftoffee
- mudkipp
- mmwwwashere
- i made this project!
- i like cheez so freakin
- mmmuuuccchhh
- not a hippy
- i might be a hippy
- no i am not a hippy
- i am am not a hippy
- i want a cube
- so i can convert it
- into a hippy van!
- well... a mini hippy van
- fear the hippy van!!!
- hippies :d
- what the hippy?
- it's a flyin' hippy van!
- actually i dont want
- a hippy van
- i want...
- a monster truck!!!!!
- monstah truck
- kill the moshimonsters!
- my katsuma died xd
- so did my rabbit
- bunn!es
- pencils are yummy
- firestar eats pencils!
- brambleclaw eats pencils!
- bluestar died
- because she choked
- on a pencil xd
- i eat pencils
- pencills
- oh bunny like a funny
- like a funny like a dunny
- like the money like a
- like a mummy
- like a dummy like a
- bummy like a llama!
- llama!!!!!!!!
- jayfeather loves pencils
- loves pencils a lot!!!
- does chewing on
- a pencil count as
- doin ******* to a pencil?
- eeew...
- that thought really
- is enough to make you
- stop chewing pencils...
- ...forever!
- nyanyanyanyanya
- flametail died!
- oh read night whispers
- for cr@p's sake!!!
- cr@p!!!
- firestar eats cr@p
- i wat firestar to die
- read pokemonx
- it's awesomeee!
- doo-da-doo!
- die ppl
- must...add...tags...
- 11:48
- 674 tags!
- stop waffles!!!!
- looooove softon
- kill the tag "waffles"
- v360 was here making tags
- zombies eat flesh
- gyybhbgdbyuhrfdyutrhgy6g
- banktoad
- <3 uryu <3
- facebook?
- trojan rabbitz!!!
- luigi rules mario drools
- blup
- giant something
- v360- love it tag
- explosive- do not shake!
- you've waffled the waffle
- doyvkfhgk
- wet cold dry
- mit rules!
- i fvrited this!tu mny tgs
- rabbid- daaaaaa!
- evil virus on web
- ▼►▲◄
- ▲▼◄►
- ‼‼‼‼‼
- la.
- ‼‼‼‼‼▀▄█▌▐
- blipety bloop
- ravioli? famous soup can.
- 704 tags including this 1
- mee6
- i had a cat
- he hid in a bush
- for 23 hours
- he's ok now tho :d
- this is the 711th tag!!!
- bobobob
- 715 tags
- loveit everyone- mmww
- this is ur host: mmww
- this is a funny project
- 721 tags with this one
- seen by chickpeakids
- superhalloween
- halloween colors
- i want to add a bunch mor
- e tags.
- a tag this is (yoda).
- 9*/yuo
- was qwertyuiop bald?
- thunder098 was here
- spammers!!!!!!!!!!!!!!!!!
- ____________best burrito
- lots & lots & lots & lots
- │
- omg so much tags!
- eeeckkkk
- xyzpdq:
- what is with all these t
- i helped make this longer
- pox
- jdkofjbghjk
- so many tags......
- warriors cats rule!!!!!!!
- it doesn't fit
- nevafa
- numbers and letters
- + tags
- 456\
- 789\
- number sequence
- --mis=nu
- ikt
- njr
- vhjuucju\
- ndtydjy
- whywhywhy???
- hollyice14 wuz here
- vc599 was here!
- hi everyone
- i'll help!
- superyoshifanwashere
- dapinkster612washere
- what is this junk
- add more fweaks!
- 802-348-9087
- my vc number
- call me...please
- whooooooaaaaaa duuude
- bla bla bnla
- 1243456789
- famous for tags
- hello tags!
- yippppppppy
- lol very loudddd
- astha123 was here
- there are toooi many tags
- add nothing
- warriorsforever was here!
- mmm...food!!!!!!!!!!!!!!!
- there are not too many!
- we not spammers!
- destroy!
- must... kill...
- im gunna kill ppl
- i tagged! hi-5! no? ok...
- yellowninjaotter!
- hipeeps
- press [+] plz
- who loves tacos???
- evil cheea
- *cheez
- bahahahahaha.
- this is silly but still..
- wonder how many tags...?
- a lot!
- yeah please die
- imj still tagging
- imaje
- tagotag
- quocky
- idtag
- commentme
- cmen
- chea
- kihg
- r5y
- hgtoiuuuuuu
- dfgsg
- aweeeeefddddddsaaaaffff
- ttaggmee
- bordom give me ice cream
- cutiecutielaurn was here!
- lauren*
- mmww we can still add
- u r weird
- go mmww!!!!
- oh man alot of !
- wow so many tags!!!!!!!!!
- vabo
- crazykittens
- shut up!!!!!!!!!!!!!!!!!!
- omg this is super loads
- epic ducks
- i luv tacos 8)
- addin tags take long time
- laa de daa
- epic epic e-pic! *dances*
- ahh what should i add now
- laaaaaah me sick- mmww
- =) me happy
- over 1000 tags!
- laah me sicker
- laaaah me sickest
- viewed by higejolly
- is the best burito
- rebecca black
- viewed by santaisonfacebo
- 3dsi
- amaze
- rebecca black friday
- i'm soooooooo stupid.
- hretadradipapa
- gift of a dream...
- the 165th ice age came
- i hate my computer
- all of the sudden
- "i existed."
- shake yoah grooove thang
- what a surprise
- the world ends 2012
- shrublike bodies
- icerosewashere
- strange how many
- a project can get
- with this idea.
- call me phil
- no my name's fred now.
- changed it back to phil
- my child...
- i fought to the death
- i know where you live...
- i got yo number
- pork roast
- i still wear diapers
- i have schitzophrania
- i didn't spell that right
- who invented math?
- come my child
- come my child.
- come my child...
- the wolves are cool
- tagstagstagstagstagstags
- shoes!
- kamokat360isepic
- wallawalla
- y'know what time it is?
- llama time!xd
- the koalas are comin
- omg i found an easter egg
- this=epic
- no santa dont eat that om
- cubed ice
- katstorm99-approved
- awesome chaos
- nyan cat
- i have 3 noses
- ´†¥´®¨©˙∆˜ƒƒ√
- my poor server
- poor server...
- freakly epic noob freakly
- songob skwearpot
- ukbgjj
- l☣cke_
- http://techblog.geek.nz/
- i is awesome
- techblog.geek.nz
- _e
- __c
- ___h
- ____b
- _____l
- ______o
- _______g
- 4scii4nd¥e5hallЯeceive
- ´._.`
- weegee's power level
- cats will take over
- bananas rule!!!!!!!!!!!!!
- kirby will eat us all!!!
- justin bieber is a fail!!
- mama luigi!
- lick mmww
- super sayain gohan
- u.b.funkey
- ♦▼►▲◄# # ‼‼‼
- gfdgfdghfdhgdfgdf
- tag! your i- doh! missed!
- jbstinksalot
- supercalafragalisticexpea
- ladoshis
- ------_________---------
- we have ∞ tags
- <- weegee luigi ->
- tag invasion!!!
- i thought i heard someone
- say that there are like
- over 9000!!! whoa
- is incredible!!! the rea-
- son why i'm not making
- this message into a com-
- met is that there are...
- more tags!!! weegeegeegee
- justin bieber?!
- he sucks!!!
- bwaaaaaaah!!!!!!
- dtfgrstyhtryh
- hi world
- dhfgsdj
- on the di;ushzw
- yxz8a
- deyfsaxjash
- destroy all hu;kjwxiqwjxs
- why am i last?
- no youre not
- heh now ur last again
- nooooooooo!!!!!!
- u just did it again moron
- no u did
- lets stop tagging
- yes!!!!!!!!!!!
- rpg: retarded poo gun
- no more tags!!!!!!!
- yes more tags!!!!!
- heheh now ur last again
- at least ur still tagging
- no im not
- yeah u are
- u so are
- i'll stop now
- please don't leave me!!!!
- r u like an online saddo?
- yes im lonely :(
- bye moron
- dksuhcouesdhcosdhvc oisud
- wjiswqiodsjqwoidjwo
- is this guy still tagging
- now i'll stop
- he's last again :)
- please leave me alone
- do u understand stop!!!!!
- well then do it!!!!!!!
- but im bored
- coz ur such a moron!!!!!
- then y r u talkin 2 me?
- let's both stop
- hehe he
- hehe he thinks im stoppin
- jipqwahjdwqpih
- bieber is da bomb!!!!!!
- monkeys wil rise!!!!!!!!
- 2 words. go away
- that was three
- how?!
- words-go-away
- just get lost!!!!!!
- what d u hav agnst words?
- ha how did u get so funny
- u tel me u de 1 dat laugh
- this is torture
- how can u get so bored?
- the test
- what test?
- i thought it was the test
- the test called a test
- what kinda name is that?
- a name
- the test!
- what test
- hehe now ur annoyed
- i was acting
- coz i wnted 2
- i wnted u to go away...
- it wasnt possible...
- hey don't give up yet!
- i'm dying
- dying...
- then how can u type?
- hello....
- helloo!!!!
- helloooo!!!!!!!!!!!!!!!!!
- glock 18 vs.jb
- aaaaahhhhhhh!!!!!!!!!!!!!
- hehe u thought i was dead
- why wuld u do dat?
- i was acting!
- why!!
- coz i wanted to!
- ur my best fwend!
- plz dont
- whoopsy-do!
- loop-di-da!
- hmm noone 2 annoy
- im bored again
- c ya round
- what the cheese
- so many tags!!!!!!!!!!
- lolllolololololololol
- this is a chat lol
- last atg
- zyingx-ct
- destroy weegee
- partytail is 100% epic
- lol longer that comments
- that's a lot of tags
- mamma mia here we go agai
- 3450594834823478978923478
- rainbow sheepz!
- galladexd was here
- drgrdsgtrdft
- 79859
- tagitty tag tag
- kablooey
- gyfsadjgfhdsgfhgsdjkfgsk
- nbjg
- 838393njhdsjhdxjhdjd8d8d8
- kjkk
- origami3
- 10d10
- ffflllaaagggpppllluuusss
- pie-is-awsome!
- ¡™£¢∞§¶
- ⁄€‹››fififl‡
- kreeperz
- klasky cruspo
- fdgssssssssssssssssss
- yo mama is epic not
- nyancat is epic
- pokemongardevoir is epic
- pleased to meet you
- are you a tagger too?
- bwah-de-bwah-de-bwah
- ipods rock!
- plz 2 add moar tags
- hehe i added another tag
- i added 15 tagz so far
- lets make this game epic
- plz affirm this tag
- the last tag took 1 hour
- i just hit the love-it
- lotsaspaghetti
- (link to contest)
- the pinkie cats
- oh my gosh another tag
- death to hobbits
- a golden ring
- pacman fever pacman fever
- 2 much nyan
- dr. octagonapus blargh
- tawnytbone was here
- supernatual
- dean & sam
- ttttttttttaaaaaaaaaaggggg
- i've been rick rolled!!!
- elllooo
- was here!!!
- ((((((((((((
- so many tagz ahh!
- hot chocolate is medicine
- ✑☃☑☐☒❖№№№№
- aa so many!!!!!!
- bean dude and sticky
- poopy!
- nyan cat! :d
- aifauhn
- pointless tag!!!
- even more pointless tag!!
- most pointless tag!
- :o:o___:o:o___:o:o
- mostest pointless tag
- trhhrth
- [+] for free pie
- ug my brother is an idiot
- jaiciana was here.
- aybabtu
- 688
- ☠ skull ☠
- hundreds of tags!
- tongatoncartact
- marceline was here
- and she had muffins.
- too bad for you.
Add Tags
More Projects by mmww
-
Shadow Softwa…
8 views -
one for all, …
2 views -
Shadow Softwa…
19 views -
mmww's Forums
22 views -
Shadow Softwa…
29 views
Comments
You need to be logged in to post comments
Add a Comment
wow! 304 views!
thats a lot of tags
.o [+][flag] .o. [+][flag] ._. [+][flag] =p [+][flag] thx all tagers! [+][flag] zanni loves it! [+][flag] not [+][flag] [.] [+][flag] f [+][flag] k [+][flag] m [+][flag] s [+][flag] gokiki [+][flag] zanni wuz here [+][flag] goku [+][flag] oranges [+][flag] iliketurkeyto [+][flag] i [+][flag] think [+][flag] got [+][flag] an [+][flag] ipod [+][flag] add tags to the tags [+][flag] touch? [+][flag] ooooo [+][flag] - [+][flag] cooless [+][flag] aaaaaaaaaaaaaaaa [+][flag] wow [+][flag] somanytags [+]
story [+][flag] simulation [flag] music [+][flag] game [flag] art [flag] animation [flag] hi [+][flag] gome [+][flag] ilikecheez [+][flag] cheez!!! [+][flag] goham [+][flag] mmww [+][flag] likes [+][flag] cheez [+][flag] so [+][flag] much [+][flag] add [+][flag] tags [+][flag] super [+][flag] duper [+][flag] pretty [+][flag] plz [+][flag] ?????? [+][flag] zanni doesnt get it. [+][flag] cake now~! [+][flag] go+me= go-me!!!! [+][flag] :) [+][flag] :3 [+][flag] :9 [+][flag] :o [+][flag] cmon peepz
Wow how many tags are there?!?
its so slooow...I've added 16 tags, though!
lol
I added another tag Called "so much trouble!"
I Added A Tag Named "fail"!
i added 'thats a lot of tags'
holy cow i just looked at the tags there are like 3450594834823478978923478902789036039690905603469234690490459056904568905 tags!!!
did u add any?
(view all replies)i've added 1!
I'll add 50
give or take 49 lol
YAY!!!! TAGS!!!!!! AWSOME CHAOS!
add me be my friend :) :) :)
OK fine
um no thx
(view all replies)i added 5 tags at the bottom!! lets be friends!!!! add this to my gallery!!!
how tags does this have currently?
I dunno, count them!
I like this.
if u added tags ur awesome
???
just add tags!!!!
That story about the cat hiding in the bush is true!
added 40+ tags? I have!
I've added loads
Want me to put copies of this project on really famous projects like the beach videos?
uh..... okay. But if someone gets mad at u dont blame me.
(view all replies)Added 20 tags. I wanted to add more but the server stuffed up :C
u can still add tags then! =D
(view all replies)one project i added 250 tags less than 2 hours
yay!
I've just I've added 30 tags in about 3 mins
thx!
yah
lol.. i already did this on platform, oh well its still fun
SO MANY TAGS!
u stole this idea from platform710_xtra!
it was a good idea.... yep, me copied... (obviusly)
(view all replies)That's alot of tags.
and theres gonna be more!
we cant add no more
oh wait..... yes we can!
(view all replies)ur right! o poop
(view all replies)